Capture, Unfolding, and Detection of Individual tRNA Molecules Using a Nanopore Device

W1541777207 · 수집 2026-10-04 18:12:13

T10409 Fuel Cells and Related Materials

CoT 라벨링

라벨링 전

PDF 파일

자동 다운로드한 PDF PDF 보기

기본 정보

DOI 제목 발행년도 저널 URL 페이지 열기 PDF URL PDF 열기 발행기관 피인용수 라이선스

추가 정보 초록

Transfer RNAs (tRNA) are the most common RNA molecules in cells and have critical roles as both translators of the genetic code and regulators of protein synthesis. As such, numerous methods have focused on studying tRNA abundance and regulation, with the most widely used methods being RNA-seq and microarrays. Though revolutionary to transcriptomics, these assays are limited by an inability to encode tRNA modifications in the requisite cDNA. These modifications are abundant in tRNA and critical to their function. Here, we describe proof-of-concept experiments where individual tRNA molecules are examined as linear strands using a biological nanopore. This method utilizes an enzymatically ligated synthetic DNA adapter to concentrate tRNA at the lipid bilayer of the nanopore device and efficiently denature individual tRNA molecules, as they are pulled through the α-hemolysin (α-HL) nanopore. Additionally, the DNA adapter provides a loading site for ϕ29 DNA polymerase (ϕ29 DNAP), which acts as a brake on the translocating tRNA. This increases the dwell time of adapted tRNA in the nanopore, allowing us to identify the region of the nanopore signal that is produced by the translocating tRNA itself. Using adapter-modified Escherichia coli tRNA(fMet) and tRNA(Lys), we show that the nanopore signal during controlled translocation is dependent on the identity of the tRNA. This confirms that adapter-modified tRNA can translocate end-to-end through nanopores and provide the foundation for future work in direct sequencing of individual transfer RNA with a nanopore-based device.

본문

_Edited by:_
_Nikola Kneževic,_
_European University, Serbia_

_Reviewed by:_
_Samir M. Iqbal,_
_Purdue University, USA_

_Rebecca Medda,_
_University of Heidelberg, Germany_

_*Correspondence:_
_David L. Bernick,_
_Nanopore Research Group,_
_Department of Biomolecular_
_Engineering, University of California_
_Santa Cruz, 1156 High Street, Santa_

_Cruz, CA 95060, USA_
_[dbernick@soe.ucsc.edu](mailto:dbernick@soe.ucsc.edu)_

_Specialty section:_
_This article was submitted to_
_Nanobiotechnology, a section of the_
_journal Frontiers in Bioengineering and_

_Biotechnology_

_Received:_ _11 April 2015_
_Accepted:_ _10 June 2015_
_Published:_ _24 June 2015_

_Citation:_
_Smith AM, Abu-Shumays R,_
_Akeson M_ _and Bernick_ _DL (2015)_
_Capture, unfolding, and detection of_

_individual tRNA molecules using_

_a nanopore device._
_Front. Bioeng. Biotechnol. 3:91._

_[doi: 10.3389/fbioe.2015.00091](http://dx.doi.org/10.3389/fbioe.2015.00091)_

[METHODS](http://www.frontiersin.org/Bioengineering_and_Biotechnology/editorialboard)
[published: 24 June 2015](http://www.frontiersin.org/Bioengineering_and_Biotechnology/editorialboard)
[doi: 10.3389/fbioe.2015.00091](http://dx.doi.org/10.3389/fbioe.2015.00091)

# Capture, unfolding, and detection of individual tRNA molecules using a nanopore device

_[Andrew M. Smith](http://loop.frontiersin.org/people/233914/overview)_ _1,2_ _[, Robin Abu-Shumays](http://loop.frontiersin.org/people/238821/overview)_ _2_ _, Mark Akeson_ _2,3_ _[and David L. Bernick](http://loop.frontiersin.org/people/43819/overview)_ _2*_

_1 Department_ _of_ _Chemistry_ _and_ _Biochemistry,_ _University_ _of_ _California_ _Santa_ _Cruz,_ _Santa_ _Cruz,_ _CA,_ _USA,_ _2 Department_ _of_
_Biomolecular Engineering, University of California Santa Cruz, Santa Cruz, CA, USA,_ _3_ _Genomics Institute, University of California_
_Santa Cruz, Santa Cruz, CA, USA_

Transfer RNAs (tRNA) are the most common RNA molecules in cells and have critical
roles as both translators of the genetic code and regulators of protein synthesis. As such,
numerous methods have focused on studying tRNA abundance and regulation, with
the most widely used methods being RNA-seq and microarrays. Though revolutionary
to transcriptomics, these assays are limited by an inability to encode tRNA modifications in the requisite cDNA. These modifications are abundant in tRNA and critical to
their function. Here, we describe proof-of-concept experiments where individual tRNA
molecules are examined as linear strands using a biological nanopore. This method
utilizes an enzymatically ligated synthetic DNA adapter to concentrate tRNA at the
lipid bilayer of the nanopore device and efficiently denature individual tRNA molecules,
as they are pulled through the α-hemolysin (α-HL) nanopore. Additionally, the DNA
adapter provides a loading site for ϕ29 DNA polymerase (ϕ29 DNAP), which acts as
a brake on the translocating tRNA. This increases the dwell time of adapted tRNA in the
nanopore, allowing us to identify the region of the nanopore signal that is produced by the
translocating tRNA itself. Using adapter-modified _Escherichia coli_ tRNA fMet and tRNA Lys,
we show that the nanopore signal during controlled translocation is dependent on the
identity of the tRNA. This confirms that adapter-modified tRNA can translocate end-toend through nanopores and provide the foundation for future work in direct sequencing
of individual transfer RNA with a nanopore-based device.

Keywords: tRNA, nanopore, nanotechnology, RNA sequencing, single molecule

Introduction

Transfer RNAs (tRNA) decode genetic information, delivering to the protein-synthesizing ribosome
the individual amino acids specified by each codon of a messenger RNA. In light of this, it
is unsurprising that they are the most numerous RNA species in the cell, composing approximately 80% of the RNA molecules per generation in yeast (Phizicky and Hopper, 2010). These
small, non-coding RNA molecules contain numerous post-transcriptionally modified nucleotides,
which contribute to tRNA fold stabilization, codon recognition, and aminoacylation [reviewed
in Gustilo et al. (2008) and Motorin and Helm (2010)]. A growing body of research indicates
that tRNAs and their nucleotide modifications are directly targeted for regulation as well as
acting as potential regulators themselves [reviewed in Yi and Pan (2011) and Raina and Ibba
(2014)].

Current methods for analysis of tRNAs, and RNA in general, include RNA-seq, microarray, and mass spectrometry. These
methods are proven tools for detection of novel tRNAs and global
tRNA expression patterns (Dittmar et al., 2006; Chan et al., 2011).
However, each method has limitations.

High-throughput RNA sequencing (RNA-Seq) methods
require extensive library preparation, including PCR
amplification, to prepare cellular RNA for sequencing. A
reverse transcription (RT) step is necessary to copy the original
RNA sequence to cDNA, which results in loss of the original RNA
strand. Additionally, the RT step is impeded by the occurrence
of structure and nucleotide modifications, which are both
commonly found in tRNAs. These “RT-stops” result in truncated
cDNA. While these RT stops have been exploited by various
methods to infer structure or nucleotide modification state in
RNA, they do not permit direct detection of nucleotide sequence
and modification identity along intact RNA (Omer et al., 2000;
Merino et al., 2005; Bernick et al., 2012; Vilfan et al., 2013).
Methods have been developed for detecting a few specific RNA
modifications, such as bisulfite treatment for 5-methylcytosine
or immunoprecipitation for N6-methyladenine, but these require
additional labor-intensive steps (Schaefer et al., 2009; Dominissini
et al., 2012).

Microarrays share a similar problem with loss of modification
information and extended processing times. Success has been
reported in detecting nucleotide modifications in tRNAs that
affect hybridization of the target molecule to array probes, which
limits detection to those modifications that affect Watson–Crick
base-pairing (Hiley et al., 2005; Saikia et al., 2010). In addition,
microarray probe design requires prior knowledge of the target
sequence, which limits detection to known RNAs.

Liquid chromatography coupled to mass spectrometry (LCMS) has also been applied to study tRNAs. In particular, two
recent publications have used LC-MS to examine dynamic
changes in tRNA modification state in _Saccharomyces_ _cerevisiae_
under varied environmental growth conditions (Chan et al., 2010,
2012). However, the nucleolytic fragmentation that is required by
this method prevents observing modifications in the full sequence
context of the tRNA.

Detection of tRNA subpopulations that result from variability
in modification, as seen in mitochondrial diseases, will benefit from direct interrogation of intact, single tRNA molecules
(Suzuki et al., 2011). In two specific mitochondrial examples,
failed tRNA modifications cause dysfunctional translation of
mitochondrial enzymes. These in turn result in the mitochondrial encephalopathies, myoclonic epilepsy with ragged-red fibers
(MERRF), and mitochondrial encephalomyopathy, lactic acidosis,
and stroke-like episodes (MELAS) (Yasukawa et al., 2001; Kirino
et al., 2004). In these examples, a method that examines individual
tRNA molecules could reveal the extent of incompletely modified
or mutant forms in these complex disease phenotypes.

Nanopore sensors interrogate single molecules and should
allow for examination of several thousand individual tRNA in
a single experiment. Nearly 20 years ago, biological nanopores
with 1–2 nm limiting apertures were conceived as single-molecule
sensors for nucleic acids (Kasianowicz et al., 1996). In concept,
the nucleotide sequence of an individual molecule would be read

by observing changes in ionic current as the linearized strand
is electrophoresed through the nanopore aperture. Recent developments in sensing DNA have coupled an enzyme to regulate
DNA movement in single nucleotide steps through a nanopore,
which produced ionic current traces that provide a single base
readout of DNA sequence (Cherf et al., 2012; Manrao et al., 2012).
Additionally, experiments by our group and others have shown
that DNA cytosine modifications can be detected with high confidence from individual nanopore reads of chemically synthesized
DNA (Laszlo et al., 2013; Schreiber et al., 2013). Applying these
principles should provide a high-throughput method to directly
examine tRNA nucleotide sequence.

With RNA, strand sequencing with single-nucleotide resolution
has yet to be demonstrated with a nanopore device. However,
Ayub and Bayley have shown that immobilized RNA strands
within a modified α-HL nanopore apparatus yield distinct ionic
current amplitudes that discriminate between canonical and select
modified ribonucleotides (Ayub and Bayley, 2012). Further, solidstate nanopores with pore-sizes that exceed 3 nm have been
shown to distinguish folded tRNA molecules from linear doublestranded RNA and DNA (Wanunu et al., 2010). By extension,
these results suggest that nanopore sensors could detect submolecular features of tRNA, including nucleotide modifications,
if tRNAs can be mechanically unfolded and electrically motivated
to pass through the pore.

With this in mind, we sought to develop a mechanism to
specifically capture tRNA molecules, promote their mechanical
unfolding, and initiate threading of the linearized strand through
the nanopore lumen. To this end, we designed an oligonucleotide
adapter that can be attached to intact tRNAs. To slow tRNA
translocation through the pore, we employed a non-catalytic
protein “brake” that loads onto the adapter. This allowed us to
determine the direction of strand translocation and provided
sufficient resolution to determine ionic current signal features
associated with the translocating adapter and the tRNA. Results
presented here demonstrate that tRNA attached to such an adapter
and modulated by a protein brake can be completely translocated through the α-HL nanopore, and that _Escherichia_ _coli_
tRNA fMet and tRNA Lys produce differentiable nanopore signals
in this system. This provides the foundation for future work
aimed at achieving single nucleotide resolution of individual
transfer RNA.

Materials and Methods

Oligonucleotide Synthesis and Purification
All oligonucleotides were synthesized by the Stanford Protein
and Nucleic Acids facility (PAN) using standard phosphoramidite
chemistry. Oligonucleotides were purified by denaturing 7M
urea polyacrylamide gel electrophoresis (PAGE) in 1 _×_ TBE, followed by overnight elution from an excised band at 4°C in
300 mM Sodium Acetate pH 5.2 and 1 mM EDTA. DNA was
precipitated and recovered by adding 100% molecular biology
grade ethanol (Sigma Aldrich) to 70% final v/v and centrifuged
for 30 min at 14,000 _× g_ and 4°C. Alternately, RNA-containing
oligonucleotides were recovered by precipitation in 75% ethanol
v/v and centrifuged at 14,000 _× g_ for 30 min at 4°C. The ethanol

mixture was aspirated and oligonucleotides were then washed
with an equal volume of 70 or 75% ethanol and pelleted again
for 10 min at 14,000 _× g_ and 4°C. Ethanol was aspirated and the
pellets were allowed to dry under vacuum to remove residual
ethanol. Oligonucleotides were then resuspended in nuclease free
water, quantified by Nanodrop (Thermo Scientific), and stored
at _−_ 80°C.

Adapter Design and Hybridization
The two oligonucleotides of the tRNA adapter were designed to
form a partially double-stranded y-shape. The design included
one end that targeted the ACCA tail of tRNA, while the other
end contained unpaired single stranded regions (see Figure 1A ).
The adapter strands also included positions where abasic (1 _′_ -H
deoxyribose) residues were incorporated to act as ionic current
markers for the different ends of the adapted RNA molecule.

5 _′_ leading strand oligonucleotide (bolded italicized bases indicate RNA; plain letters are DNA, X indicates an abasic 1 _′_ H deoxyribose): 5 _′_ -CTCACCTATCCTTCCACTCATACTATCA
TTATCTXTCAGATCTCACTA _UCUGGU-_ 3 _′_ .

3 _′_ trailing strand oligonucleotide (X indicates an abasic 1 _′_ H deoxyribose; Z is a triethylene glycol-cholesterol): 5 _′_ -phosGATXGTGAGATCTGATTTTTTTTTTTTTTTZ-3 _′_ .

For experiments to determine which end of the adapted RNA
molecules entered the pore first, new adapter nucleotides were
synthesized with one of the abasic markers (as indicated above)
replaced by the nucleotide that restored complementarity in the
double stranded portion of the adapter. In these experiments,
one of the following oligonucleotides replaced its corresponding
abasic-containing strand in the adapter:

5 _′_ leading strand oligonucleotide: 5 _′_ -CTCACCTATCCTTCCA
CTCATACTATCATTATCTCTCAGATCTCACTA _UCUGGU_ -3 _′_ .

3 _′_ trailing strand oligonucleotide: 5 _′_ -phos-GATAGTGAGATC
TGATTTTTTTTTTTTTTTZ-3 _′_ .

Adapters were formed by combining leading and trailing
strands at 100 µM in 10 mM Tris-HCl pH 8 and 50 mM NaCl. The
mixture was heated to 95°C for 30 s and allowed to cool to room
temperature.

RNA, RNA Ligation Reaction, and Purification of
Full-Length Products
_Escherichia_ _coli_ tRNA Lys and tRNA fMet were purchased from
Sigma-Aldrich. The RNA hairpin control was prepared
by the Stanford PAN facility using the sequence 5 _′_ -phosCGCGGGGUUUUUCCCCGCAACCA-3 _′_ . RNA substrates
were ligated to adapters using RNA Ligase 2 (NEB). Ligation
reactions were carried out in 20 µL of buffer recommended by
the manufacturer supplemented with 0.5 mM ATP, 5% PEG
8000, and 2 µM each of RNA and adapter. To end the reaction
and prepare the sample for purification, 50 µL urea loading
buffer (7M urea and 0.1 _×_ TBE) was added to the sample and
heated to 95°C for 5 min. The products were separated on a
7M urea PAGE gel in 1 _×_ TBE. The gel was post-stained with
2 _×_ SybrGold (Life Technologies) and product of appropriate
size for the complete ligation product was excised. Ligated RNA
was recovered by electroelution into 3.5 kDa MWCO D-tubes
(Novagen) at 100 V for 2 h in 1 _×_ TBE. Recovered ligated RNA

FIGURE 1 | Strategy for constructing adapter-linked tRNA molecules
for nanopore experiments . (A) The DNA/RNA chimeric adapter (black lines;
RNA nucleotides black letters) was composed of a double stranded region
and a four nucleotide RNA overhang (UGGU) ligated to the tRNA (cyan). The
adapter specifically targets the conserved CCA tail of deacylated, native
tRNA. Phosphodiester bonds formed by enzymatic ligation between the tRNA
and the adapter are indicated by dashes between the 3 _′_ terminal nucleotide
and 5 _′_ phosphate (p) at ligation junctions. The boxed tail regions were a
single-stranded DNA (ssDNA) leader used for nanopore capture and a
poly(dT) region with a terminal TEG-linked (triethylene glycol) cholesterol. This
terminal TEG-cholesterol on the 3 _′_ adapter strand was designed to localize
substrate at the lipid bilayer. Tails are not drawn to scale. The adapter
nucleotides are numbered relative to the first and last nucleotide of a canonical
tRNA. The X’s indicate abasic positions. (B) Denaturing PAGE analysis of
tRNA-adapter ligation reaction (see Materials and Methods). Time points are
in minutes. Lanes 1–3, control reaction with _S. cerevisiae_ tRNA Phe (76 nt) and
adapter (54 nt leader strand), but absent RNA Ligase 2 (RNL2). Lanes 4–6, _S._
_cerevisiae_ tRNA Phe incubated with the adapter and RNL2. Lanes 7–9, control
reaction with RNL2 but absent adapter. Lanes 10–12, control reaction absent
tRNA Phe . The 31 nt 3 _′_ adapter oligonucleotide stains poorly (not shown). All
subsequent nanopore experiments were conducted with complete ligation
products after gel purification (see Materials and Methods).

preparations were ethanol precipitated, quantified by Nanodrop
(Thermo Scientific), and stored at _−_ 80°C.

Nanopore Experiments
Nanopore experiments were performed using a single α-HL
nanopore (indicated by a step-wise increase in ionic current,
range 68.0–72.5 pA) embedded in a planar 1,2-diphytanoyl-synglycero-phosphatidylcholine bilayer established on a ~25 µM
aperture, as described previously (Akeson et al., 1999). Experiments were conducted in 0.3M KCl and 10 mM HEPES pH 8.0
at 28°C ( _±_ 0.4°C) at 180 mV ( _trans_ well positive). Dithiothreitol

(2 mM final) and EDTA pH 8.0 (1 mM final) were added to the
well on the _cis_ side of the bilayer. In the case of experiments
looking at the effect of Mg 2+, MgCl2 was added to the buffer
to 5 mM and EDTA was omitted from the _cis_ side well. Nucleic
acid substrates were added to 0.5 nM, unless otherwise noted to
the _cis_ well, and allowed to incubate 2 min to associate with the
bilayer. For experiments where ϕ29 DNAP was to be added, an
additional 12.5 min incubation was allowed; during this period,
we observed captures of unbound RNA substrate prior to adding
ϕ29 DNAP (Enzymatics) to 75 nM. Ionic current measurements
were collected with an Axon Axopatch 200B (Molecular Devices)
patch-clamp amplifier in whole-cell, voltage-clamped mode, and
filtered with an analog low-pass Bessel filter at 5 kHz, then digitized using an Axon Digidata 1440A analog-to-digital converter
(Molecular Devices) at 100 kHz bandwidth.

Event Detection and Ionic Current Region
Measurements
For nanopore experiments that examined populations of ionic
current blockade events, a custom developed event detection
program was used [(https://github.com/jmschrei/PyPore).](https://github.com/jmschrei/PyPore) The
detection algorithm identified ionic current blockades that were
self-terminating by selecting for segments that deflected from
open nanopore current (68.0–72.5 pA) below a cutoff of 45 or
55 pA and with a minimum duration of _>_ 0.1 ms, where voltage
was not reversed to eject the stand from the pore (current never
_<_ 0 pA). For experiments where individual ionic current blockade
events were examined, raw nanopore ionic current data were filtered with a digital 2 kHz low-pass Bessel filter and analyzed using
Clampfit 10.4 (Molecular Devices). For ϕ29 DNAP molecular
braking experiments, events were selected from current blockades
that had durations >1 s and self-terminated. Event classification
from adapted RNA(hairpin) substrates were analyzed as articulated in the text. For adapted tRNA data, complete translocation
events were selected based on the criteria that they contained
exactly two abasic-dependent regions; these were defined as high
current regions with a mean current >33.5 pA, <36.5 pA, and minimum a duration >2 ms. After selection as complete translocation
events, duration and mean current for states I–III were measured
by hand using Clampfit’s internal statistics measuring program.

Semi-Logarithmic Decision Boundary and
Accuracy Derivation
Event durations were transformed to log-durations (log10) and
a linear decision boundary was established using the kernlab
(v 0.9–19) package (Karatzoglou et al., 2004) under R (v 3.0.2). The
ksvm parameters used were “type = ‘C-svc,’ kernel = ‘vanilladot,’
_C_ = 10” to produce a soft-margin decision boundary. To assess
classification accuracy, a fivefold training/test regimen was used.
The data set was shuffled and then partitioned into five groups
of nearly equal size. In a series of five tests, one of the five
groups was withheld as a test set, while the decision boundary was
calculated using the remaining four. This was repeated for each of
the five groups. This procedure was repeated 50 times, providing
250 assessments of accuracy. Mean and standard deviation of
these 250 accuracy scores are reported. For this study, we used

a balanced accuracy score, calculated as the mean recall rate for
each of the two data classes. For two classes with labels {1, _−_ 1},

where true( _n_ ) are counts of test data labeled _n_, and pred( _n_ )
are counts of test data that are correctly classified. The graphic
provided in Figure 6 was derived using the full dataset and the
kernlab package with parameters as above. Margins (dotted lines)
in Figure 6 provide the optimized bounds that maximize the
proper classification of labeled data outside the margin while
minimizing the cost of misclassified data on the “wrong” side of
that margin (Cortes and Vapnik, 1995).

Results

Capture and Threading of tRNA Through the
α-HL Nanopore is Facilitated by Ligation of an
Oligonucleotide Adapter to the tRNA
Reading the nucleotide composition of individual tRNA
molecules will require capture, denaturation, and threading of
each strand sequentially through the nanopore. In our initial
experiments, we found that native tRNA molecules caused long
( _>_ 30 s) ionic current blockades of the α-HL pore (data not
shown). These molecules had to be ejected by voltage reversal to
re-establish an open-pore ionic current. This suggested that tRNA
molecules in their native form would not readily translocate
through the α-HL nanopore.

We reasoned that an extended single-stranded region, longer
than the ACCA in native tRNA, may be needed to initiate threading of each tRNA molecule into the lumen of α-HL. To accomplish
this, we devised a strategy to covalently attach synthetic nucleic
acid strands to the 3 _′_ and 5 _′_ ends of the tRNA. This was achieved
using a _Y-shaped_, partially double-stranded DNA–RNA adapter
that contained a 3 _′_ RNA overhang complementary to the universally conserved CCA tail in tRNA ( Figure 1A ). The strand of the
adapter, which bares the 3 _′_ RNA overhang, was designed to be
ligated to the 5 _′_ end of a tRNA (referred to as the “leading strand”).
The unpaired region of the leading strand contained 35 singlestranded nucleotides and was designed to facilitate capture and
threading into the nanopore. The double-stranded region of the
adapter was designed to allow a dsRNA ligation, and effectively
extended the tRNA adapter stem by 15 base-pairs.

The strand of the adapter that was designed to be covalently
attached to the 3 _′_ end of the tRNA (referred to as the “trailing
strand”) incorporated a cholesterol tag at its 3 _′_ end. This was
designed to locally concentrate the adapted tRNA at the lipid
bilayer-aqueous interface of the nanopore experimental setup.
Association of the cholesterol moiety on the 3 _′_ trailing strand with
the bilayer should favor capture of the free 5 _′_ end of the leading
strand in the electric field surrounding the nanopore. Finally, the
adapter design incorporated abasic residues into both leading and
trailing strands to act as ionic current signal markers upstream and
downstream of the ligated tRNA.

We initially tested if the adapter could be enzymatically ligated
to tRNA using T4 RNA Ligase 2 (RNL2). Analysis of that ligation

pred(1)

balanced accuracy =

predtrue((11)) + pred true( ( _−_ _−_ 1 1 ) )

true( _−_ 1)
2

reaction revealed that a product of appropriate size (~160 nt) was
generated only in the presence of both the adapter and a model
tRNA substrate ( _S. cerevisiae_ tRNA Phe ) ( Figure 1B ). These results
indicated that enzymatic ligation with RNL2 was an effective
method for adding adapter strands to this model tRNA. To test
this further, we ran additional ligation experiments with _E._ _coli_
tRNA fMet . This tRNA represented a more challenging substrate
because it contains a non-canonical nucleotide pair at the end of
the acceptor stem (RajBhandary, 1994). Our results showed that
_E._ _coli_ tRNA fMet was also a reactive substrate for ligation to the
adapter (data not shown).

Initial nanopore experiments were performed with adapted
_E._ _coli_ tRNA fMet using an established single-channel apparatus
(see Materials and Methods) ( Figure 2A ). Ionic current blockade
events were observed with a typical duration of tens of milliseconds (mean duration = 10 _−_ 2.6 _±_ 0.06 s, variation of the mean shown
as SEM) ( Figures 2B,C, magenta circles). These events were
longer than the events observed for the adapter alone, which were
typically a millisecond or less (mean duration = 10 _−_ 3.9 _±_ 0.04 s)
( Figure 2C, open triangles). The increased duration of events
with adapted tRNA fMet suggested that longer or more structured
molecules were being captured and translocated through the pore.
The extremely short duration blockade events observed with
the adapter alone were consistent with single-stranded nucleic
acids being translocated through the pore (Deamer and Branton,
2002).

FIGURE 2 | Adapted tRNA-dependent ionic current blockades
observed during single-channel α-HL nanopore experiments .
(A) Cartoon illustration of the single-channel nanopore apparatus and a
proposed adapted tRNA translocation event. (i) A constant voltage ( _trans_
side+) is applied across a single α-HL nanopore (orange) embedded in a
lipid bilayer (gray). (ii) Electrophoretic capture of an adapted tRNA (cyan)
results in a decrease in the measured ionic current through the nanopore.
(i’) Return to open channel current when the tRNA clears the pore in the
_trans_ compartment. (B) An ionic current trace from a nanopore experiment
with adapted _E. coli_ tRNA fMet (inset). Ionic current regions i–ii and i’ in the
trace (dashed lines) correspond to the proposed tRNA translocation event

If in fact the longer dwell time was caused by tRNA, then
conditions known to stabilize tRNA should increase event duration further. Magnesium ions are known to stabilize the tertiary
fold of tRNA (Stein and Crothers, 1976; Serebrov et al., 2001).
When we added magnesium chloride to the experimental buffer
(5 mM final concentration), we observed an increase in event
duration (100-fold or 2 Log10 units) relative to experiments absent
Mg 2+ (mean duration = 10 _−_ 1.4 _±_ 0.1 s) ( Figure 2C, blue squares).
These blockades were self-terminating, as seen in experiments
without Mg 2+ . This result was consistent with capture of a Mg 2+ stabilized tRNA. Together, these results suggested that the electricfield driven denaturation of secondary, and potentially tertiary
structure facilitated the translocation of tRNA through the pore.

ϕ 29 DNAP Acts as a Molecular Brake During
Translocation of Adapted RNA Under
Non-Catalytic Conditions
In previous studies with both RNA and DNA, uncontrolled
polynucleotide translocation rate through a nanopore was too
high to resolve single nucleotide-level information about the
translocating strand (Deamer and Branton, 2002). Therefore, we
sought to slow the translocation of adapted tRNA to improve
resolution of tRNA features and to provide definitive evidence
that adapted tRNA molecules transit the pore in their entirety.
Control of DNA transit rates using DNA polymerases has been
documented, and Lieberman et al. (2010) showed that ϕ29 DNAP

in (A) . The blockade event shown is typical of thousands of events observed
during nanopore experiments with adapted tRNA fMet . Scale bar indicates
50 ms. (C) Nanopore blockade mean ionic current versus duration caused
by adapted tRNA fMet in the presence or absence of Mg 2+ . The mean current
and duration of approximately 200 events are shown for representative
nanopore experiments with either adapted tRNA fMet ( _−_ Mg 2+ ) (magenta
circles) or adapted tRNA fMet (+Mg 2+ ) (blue squares). The adapter on its own
( _−_ Mg 2+ ) (open triangles) was also examined as a negative control. In all
cases, single-channel α-HL nanopore experiments were conducted at
180 mV ( _trans_ side+) with tRNA substrate at 0.5 nM in 0.3M KCl, 10 mM
HEPES (pH 8.0), and _±_ 5 mM MgCl2 (see Materials and Methods).

can serve as a “molecular brake” that controls the rate of DNA
translocation through the α-HL pore under non-catalytic conditions (absent Mg 2+ and dNTPs) (Lieberman et al., 2010). Furthermore, this molecular brake activity of ϕ29 DNAP has been
observed on a chimeric DNA–RNA substrate with a nanopore
device (J. Clarke, Oxford Nanopore Technologies, personal communication).

We wanted to determine if the ϕ29 DNAP molecular brake
could also be used to control translocation of RNA molecules
containing more complex structures, such as stem-loops found
in tRNA. For this, we synthesized a simple RNA hairpin, which
we ligated to the tRNA adapter ( Figure 3A ). This synthetic RNA

[referred to as RNA(hairpin)] mimicked the acceptor stem of
tRNA fMet, where the two halves of the acceptor stem were linked
by a short loop region of five uracil residues.

Nanopore capture of complexes formed between the adapted
RNA and ϕ29 DNAP, similar to those seen by Lieberman et al.,
should result in greatly increased dwell time of individual adapted
RNA molecules within the aperture of α-HL. This would be
observed as population of longer duration nanopore current
blockades, which would be distinct from the shorter duration
events of unbound adapted RNA strands.

Control nanopore experiments with the adapted RNA(hairpin)
construct absent ϕ29 DNAP resulted in current blockade
events with mean duration on the order of milliseconds (mean
duration = 10 _−_ 3.2 _±_ 0.02 s) ( Figure 3C, magenta circles). Addition of ϕ29 DNAP to the buffer solution containing adapted
RNA(hairpin) on the _cis_ side of the nanopore apparatus produced

FIGURE 3 | Nanopore capture of adapted RNA complexed with
non-catalytic ϕ 29 DNAP . (A) Schematic of the synthetic RNA(hairpin)
construct (cyan) covalently attached to the adapter (black). This simple RNA
hairpin is composed of a synthetic copy of the _E. coli_ tRNA fMet acceptor
stem linked by a five uracil loop. This RNA was enzymatically ligated to the
adapter as described previously (see Materials and Methods). Colored X’s
indicate 5 _′_ (blue) and 3 _′_ (red) abasic residues in the adapter strands.
(B) Representative ionic current trace during capture of an adapted RNA
hairpin complexed with ϕ29 DNAP. ϕ29 DNAP (75 nM) and adapted RNA
(0.5 nM) were added to _cis_ side compartment which contained nanopore

two different types of current blockade events. These events
typically fell into one of two populations: a short duration population (duration _<_ 0.1 s, mean 10 _−_ 2.9 _±_ 0.09 s), similar to events in
the control experiment, and a long duration population not seen
in the control experiment (duration _≥_ 0.1 s, mean 10 0.43 _±_ 0.03 s)
( Figures 3B,C, blue triangles). The shorter duration population ( _<_ 0.1 s) appeared consistent with RNA(hairpin) absent ϕ29
DNAP and was statistically indistinguishable from the event population seen in the control ( _p_ -value _<_ 0.66, two-tailed _t_ -test). The
longer duration population ( _≥_ 0.1 s) was longer in mean duration
and was statistically different from the population seen in the control ( _p_ -value _<_ 0.0001, two-tailed _t_ -test). This suggested that these
long duration events were the result of ϕ29 DNAP binding the
adapted RNA substrate and slowing strand translocation through
the nanopore.

We included two abasic residues (1 _′_ -H deoxyribose) in the
adapter strands near the ligation junctions with the RNA to act as
indicators of strand translocation (see Figure 3A ). Abasic residues
have been shown to cause distinctive high current states that
are apparent during enzyme-controlled translocation of oligonucleotides through the α-HL pore (Gyarfas et al., 2009; Lieberman
et al., 2010). Because the abasic residues in the adapter (subsequently referred to as a “dual-abasic adapter”) flank the RNA
insert, they should translocate through the nanopore before and
after the RNA insert ( Figure 4A ). This should produce an ionic
current trace with high current states bracketing an intervening
region and indicate strand translocation occurred in a linear
conformation. Further, the intervening region would correspond

buffer absent Mg 2+ and amended with 1 mM EDTA (see Materials and
Methods). The cartoons above the ionic current trace represent proposed
steps during ϕ29 DNAP-controlled translocation: (i) open channel prior to
capture of the adapted RNA: ϕ29 DNAP complex; (ii) nanopore capture and
translocation of adapted RNA bound to ϕ29 DNAP; (i’) return to open
channel current when the RNA clears the pore into the _trans_ compartment.
Scale bar indicates 1 s. (C) Mean ionic current versus duration for adapted
RNA(hairpin)-dependent blockades absent (magenta circles) or present (blue
triangles) ϕ29 DNAP. Approximately 200 events are shown for each
condition from a representative single experiment.

FIGURE 4 | End-to-end translocation of adapted RNA(hairpin)
constructs through the α-HL nanopore . (A) A cartoon model showing
capture and translocation of an adapted RNA(hairpin) complexed with ϕ29
DNAP. The adapted RNA(hairpin) substrate is described in Figure 3 . (I)
Following capture of the 5 _′_ end of the adapter strand, the polynucleotide
translocates through α-HL until the leading 5 _′_ abasic residue (blue circle)
reaches pore limiting aperture. (II) Translocation continues through the RNA
portion of the adapted molecule. (III) The trailing 3 _′_ abasic residue (red
circle) reaches the pore limiting aperture after translocation of the
RNA(hairpin). (B) A nanopore ionic current trace during translocation of an
adapted RNA(hairpin) (inset), which corresponding to the cartoon

to the adapted RNA(hairpin) insert traversing the pore. As seen
with DNA during ϕ29 DNAP-mediated translocation, the individual ribonucleobases of the extended chain should directly modulate the ionic current during translocation through the α-HL pore,
resulting in a reproducible pattern of ionic current states (Cherf
et al., 2012).

As predicted, translocation of dual-abasic adapted
RNA(hairpin) constructs bound to ϕ29 DNAP resulted in
blockade events containing two distinct ionic current states in the
range of 33.5–36.5 pA that flank a reproducible pattern of ionic
current ( Figure 4B ; Figure S1 in Supplementary Material). This
suggested that the adapted RNA(hairpin) translocated completely
through the nanopore, and that ϕ29 DNAP acted as a passive
molecular brake for both the DNA and RNA portions of the
chimeric molecule.

The Ionic Current Pattern Produced by 5 _′_ and 3 _′_

Abasic Residues Establishes the Direction of
Translocation and Indicates Complete Strand
Translocation
To establish the direction that ϕ29 DNAP-bound strands
translocated through the nanopore, it was necessary to assign each
of the observed high current states to either the 5 _′_ or 3 _′_ abasic

in (A) . The event displays two high current marker regions characteristic of
the 5 _′_ abasic residue (blue segment) and 3 _′_ abasic residue (red segment)
built into the adapter. Translocation events that contained both leading and
trailing markers were observed in ~27% of events with durations exceeding
1 s. The marker ionic current level was 33.5–36.5 pA (dashed gray lines)
under the experimental conditions used (see Materials and Methods).
Scale bar indicates 0.2 s. (C) A nanopore ionic current trace during
translocation of an adapted RNA(hairpin) (inset) bearing only the 5 _′_ abasic
residue (5 _′_ mono-abasic adapted RNA). (D) A nanopore ionic current trace
during translocation of an adapted RNA(hairpin) (inset) bearing only the 3 _′_

abasic residue (3 _′_ mono-abasic adapted RNA).

residue. To do this, we synthesized adapters that contained only
one of the 5 _′_ or 3 _′_ abasic residues. These “mono-abasic adapters”
were ligated to the RNA(hairpin) substrate (see Figure 3A, cyan).

Substrates bearing the 5 _′_ mono-abasic adapter typically produced events containing a single high current state (33.5–36.5 pA)
near the beginning of the event ( Figure4C ). Substrates bearing the
3 _′_ mono-abasic adapter caused a similar high current state near
the end of the event, which was preceded by a low current state
( _<_ = 26.5pA) ( Figure 4D ).

These observations provided an ionic current model for complete translocation of the dual abasic-adapted RNA(hairpin) in the
5 _′_ -to-3 _′_ direction. That is, the 5 _′_ abasic residue caused the first
high current state, which was followed by the intervening current
region corresponding to the RNA, which includes the low current
state. This is followed by the high current state proximal to the end
of the event that is caused by the 3 _′_ abasic residue.

Using this model, we quantified the frequency of the leading
and trailing high current states (henceforth referred to as leading
and trailing markers) in events _>_ 1 s duration. Translocation of
the dual-abasic adapted RNA resulted in 27.4% of events (102 of
372) that contained both the leading marker and trailing marker
separated by a region containing a low current segment ( Table 1 ).
An additional 43% of events were classified as containing only
a leading marker and 6.7% were classified as containing only a

TABLE 1 | RNA(hairpin) nanopore translocation events classified by detection of leading and trailing high current markers .

Substrate Events Leading and trailing
high current observed a

Leading high
current observed b

Trailing high
current observed c

Other events d

RNA(hairpin) (dual-abasic adapter) 372 102 (27.4%) 160 (43.0%) 25 (6.7%) 85 (22.9%)
RNA(hairpin) (5 _′_ mono-abasic adapter) 287 3 (1.0%) 185 (64.5%) 10 (3.5%) 89 (31.0%)
RNA(hairpin) (3 _′_ mono-abasic adapter) 285 3 (1.1%) 4 (1.4%) 108 (37.9%) 170 (59.6%)

_aThese events contained three required features as illustrated in Figure 4: (1) a high current marker segment (mean current 33.5–36.5 pA with ≥2 ms duration); (2) a low current segment_
_(mean current_ = _<26.5 pA with_ _≥10 ms); (3) a second high current segment proximal to the termination of the event._
_bThese events contained: (1) a single high current marker segment (mean current 33.5–36.5 pA with duration ≥2 ms); (2) a low current segment (mean current_ = _<26.5 pA with ≥10 ms)_
_that always followed the high current marker._
_cThese events contained: (1) a single high current marker segment (mean current 33.5–36.5 pA with duration_ _≥2 ms); (2) a low current segment_ = _<26.5 pA with a duration of 10 ms)_
_that always preceded the high current marker segment._
_dEvents classified as “other” included all events that could not be assigned to one of the other categories, such as those displaying more than two high current marker states and events_
_displaying no high current marker segments._
_All events were_ _≥1 s duration._

trailing marker. The disparity in frequency between leading and
trailing markers suggested that the 3 _′_ end of the strand was more
difficult to resolve.

The less frequent observation of the trailing marker relative to
the leading marker suggested two possible explanations: either the
3 _′_ abasic was absent from many strands, or that the translocation
rate increased in the region of the 3 _′_ abasic. In experiments
with dual-abasic molecules, where both 5 _′_ and 3 _′_ abasic markers
were resolved, the duration of the 3 _′_ marker is notably shorter
( Figure 4B ; Figure S1A in Supplementary Material), supporting
the latter hypothesis. Furthermore, in experiments with constructs
containing mono-abasic adapters, we observed the same trends:
strands bearing the 5 _′_ mono-abasic adapter produced events with
a single high current region 64.5% of the time with notably longer
duration ( Table 1 and Figure 4C ; Figure S1B in Supplementary
Material), and strands bearing the 3 _′_ mono-abasic adapter produced a smaller fraction of events (37.9%) with a single highcurrent marker of shorter duration ( Table 1 and Figure 4D ; Figure
S1C in Supplementary Material). This suggests that the translocation rate of the molecule increases after ϕ29 DNAP unzips the
double stranded region. This would produce shorter duration
ionic current signatures at the 3 _′_ end. We reasoned that these
shorter duration 3 _′_ trailing markers were frequently unresolved
at the measurement timescale used by our apparatus.

The result of the experiments using mono-abasic markers is
consistent with 5 _′_ -to-3 _′_ traversal of adapted RNA through the αHL pore when bound to ϕ29 DNAP. By design, the 3 _′_ end of
adapted RNA would be retained in or at the lipid bilayer. This
would preferentially leave the 5 _′_ end of adapted RNA molecules
available to initiate threading through the pore and act as the
loading site for ϕ29 DNAP. By experiment, when a single abasic
residue was present only on the leading strand of the adapter
(5 _′_ ), we observed a single long-duration high current marker
toward the beginning of ϕ29 DNAP-bound translocation events.
Conversely, inclusion of a single abasic residue only on the trailing
strand of the adapter (3 _′_ ) produced a single short-duration high
current marker toward the end of ϕ29 DNAP-bound translocation
events. Presence of both abasic residues in the adapter resulted
in ~27% of ϕ29 DNAP-bound translocation events containing
two high current markers. Taken together, these results support
initiation of the ϕ29 DNAP-bound strand threading through the
nanopore from the 5 _′_ end, followed by the RNA portion, and
terminating with the 3 _′_ end of strand passing through and exiting

the pore. A 5 _′_ -to-3 _′_ voltage-driven “unzipping” process was previously observed for ϕ29 DNAP under non-enzymatic conditions
on DNA (Lieberman et al., 2010). We conclude from the results
presented here that: ϕ29 DNAP is being driven in the 5 _′_ –3 _′_

direction, it unzips the dual-abasic adapted RNA(hairpin) strand,
and in events where both markers were observed, the strand is
translocated through the nanopore in its entirety. Further, these
markers provide approximate boundaries of the RNA-dependent
portion of the nanopore signal.

_E. coli_ tRNA fMet and tRNA Lys can be Classified
Based on Their Nanopore Current Signals
If the ionic current segment flanked by the high current markers
contains the RNA-dependent portion of nanopore signal, then
that region should differentiate tRNA species. Further, a tRNAspecific change seen in the putative RNA-dependent region, when
bordered by the adapter-dependent marker regions, would be
evidence that the adapted tRNA translocate entirely through the
nanopore. We used the ϕ29 DNAP-mediated braking method,
as had been done with the RNA(hairpin) substrate, to improve
temporal resolution of adapted tRNA. For this experiment,
we selected two well-characterized tRNA species for nanopore
analysis, _E. coli_ tRNA fMet and _E. coli_ tRNA Lys . These tRNAs exist
in the _E._ _coli_ genome as either a single isoform (tRNA Lys ) or as
two isoforms that differ by only a single nucleotide (tRNA fMet )
(RajBhandary, 1994). Additionally, tRNA Lys and tRNA fMet have
similar lengths (76 and 77 nt, respectively), but have significantly
different nucleotide compositions (50.0 and 64.9% G-C content,
respectively), and would be expected to generate different ionic
current signals.

Experiments with the adapted tRNA fMet substrate produced 85
events that contained the leading and trailing markers bracketing an extended intervening current region (17.6% of 481 total
events) ( Figure 5A ; Figure S2 in Supplementary Material). Experiments with the adapted tRNA Lys substrate produced 77 events
that contained the leading and trailing markers also bracketing an
extended intervening current region (22.3% of 348 total events)
( Figure 5B ; Figure S2 in Supplementary Material). As suggested
by the results with the adapted RNA(hairpin) substrate, these
events were presumed to result from complete translocation of the
adapted tRNA through the nanopore. These events were selected
for further analysis of tRNA-specific ionic current signal.

FIGURE 5 | Adapted _E. coli_ tRNA fMet and tRNA Lys translocate through
the α-HL nanopore . (A) A representative nanopore ionic current trace for
adapted _E. coli_ tRNA fMet . The rate of translocation through the nanopore is
controlled by ϕ29 DNAP (see Figure 3 ). The leading high current marker (I, blue
segment) and the trailing high current marker (III, red segment) correspond to
the 5 _′_ abasic residue and 3 _′_ abasic residue transiting the nanopore, as in
Figure 4B . Region II of the trace contains the portion of the nanopore signal
associated with tRNA translocation. Translocation events that contained both 5 _′_

and 3 _′_ current markers were observed in ~20% of all events with durations
exceeding 1 s. Scale bar indicates 1 s. The inset shows a magnified view of the

trailing 3 _′_ high current marker. Scale bar indicates 0.1 s. (B) A representative
trace from nanopore experiments with adapted tRNA Lys . Details are the same as
in (A) . (C) A cartoon model of an adapted tRNA as it transits the α-HL
nanopore. The panels to the left and right correspond to open channel before
and after tRNA translocation (see Figure 3 ). Roman numerals correspond to the
roman numerals in (A,B) . (I) Translocation of the leading adapter strand through
α-HL until the 5 _′_ abasic residue (blue circle) reaches the pore limiting aperture.
(II) Translocation of the tRNA portion of the adapted molecule. (III) Translocation
of the trailing adapter strand and 3 _′_ abasic residue (red circle) through the pore
limiting aperture after translocation of the tRNA.

the regions (see Materials and Methods). Regions I and III provided discrimination between the two tRNA only slightly better
than chance at 60.0 _±_ 6.9 and 59.4 _±_ 7.0% accuracy, respectively.
In contrast, the putative tRNA dependent region II provided a
classification accuracy of 87.2 _±_ 5.3%. This result demonstrated
quantitatively that tRNA contributed to the nanopore signal in
region II. Further, because the adapter-dependent regions I and III
flanked region II, as they do in the adapted tRNA oligonucleotide
strand, we concluded that adapted tRNA translocated completely
through α-HL as an unfolded, linear strand in these instances.

Discussion

In summary, we have shown that individual biological tRNA
molecules can be unfolded and translocated through a nanopore
as linear strands. To facilitate this, we developed a double-stranded
oligonucleotide adapter that could be enzymatically ligated to
biological tRNA. The two strands of the adapter acted to locally
concentrate adapted tRNA at the bilayer and to initiate strand
threading through the nanopore. Using ϕ29 DNAP under noncatalytic conditions, we were able to slow strand translocation
through the pore. This allowed us to observe adapted tRNA
translocating 5 _′_ -to-3 _′_ through the pore as a linear strand when

To test the putative RNA-dependent region for tRNA-specific
signal (see Figures 5A,B, region II), we segmented the ionic current signal from each translocation event into regions I through
III. As was the case for the RNA(hairpin) substrate (see Figure 4 ),
regions I and III included the leading and trailing markers, respectively, which corresponded to the 5 _′_ and 3 _′_ abasic residues of
the adapter translocating through the nanopore. These served as
control regions for our analysis ( Figure 5C ). Bracketed by these
markers, region II was expected to change based on the identity
of the tRNA. Initial inspection of ionic current parameters, mean
current, and dwell time suggested that Region II provided the
best discrimination between tRNA fMet and tRNA Lys ( Figure 6 ). As
expected, mean current and duration for regions I and III did not
appear to differ between tRNA fMet and tRNA Lys .

To quantitatively assess the influence of tRNA type on ionic
current, we analyzed the data in Figure 6 using a soft-margin
support vector machine (SVM) (Cortes and Vapnik, 1995). A
SVM was used to quantify the discrimination between the two
tRNA species using their ionic current parameters in each of
the three regions. The SVM produced an optimal linear decision
boundary for the event log-durations and mean currents plotted in
Figure 6 . We used 5-way cross validation to calculate classification
accuracy (mean and SD) of the boundaries produced for each of

FIGURE 6 | Classification of tRNA molecules using duration and
mean ionic for regions I–III of adapted tRNA translocation events .
We collected complete ionic current events (approximately 80 for each
class) from experiments ( _n ≥_ 5) using adapted _E. coli_ tRNA fMet (blue
squares) or adapted tRNA Lys (magenta circles). In our model ( Figure 5C ),
regions I and III correspond to the common leading and trailing marker
regions, respectively, and region II corresponds to the intervening
RNA-dependent portion of the signal. The _x_ -axis is the duration of a given
region and the _y_ -axis is mean current for that region. In each panel, the

bound by ϕ29 DNAP. Finally, as evidence that tRNA influenced
ionic current during translocation, we show that _E. coli_ tRNA fMet

and tRNA Lys produced differentiable ionic current signals.

Linear translocation of biological tRNA through the nanopore
is a first step toward single-molecule direct sequence analysis of tRNA. Full implementation of a nanopore-based RNA
sequencing method will require the following improvements:
(1) _increased_ _sensitivity_ _of_ _the_ _nanopore_ : for example, pores
derived from mycobacterial species provide nucleotide-level sensitivity for DNA sequencing (Manrao et al., 2012). (2) _Regu-_
_lation_ _of_ _tRNA_ _movement_ _in_ _single_ _nucleotide_ _steps_ : this may
be accomplished by coupling an active molecular motor to
translocate tRNA, as has been accomplished for DNA sequencing using ϕ29 DNAP in a catalytic mode (Laszlo et al.,
2014). (3) _Correlation_ _of_ _ionic_ _current_ _states_ _with_ _nucleotide_
_identity_ : this has been achieved for canonical DNA bases
and for various cytosine modifications (Manrao et al., 2012;
Schreiber et al., 2013; Wescoe et al., 2014). (4) _Increased_
_throughput_ : for example, use of multi-channel nanopore devices
will allow for reading tens of thousands of individual tRNA
molecules.

Mitochondrial tRNA (mt.tRNA) genes comprise <10% of
the mitochondrial genome (16,569 bp), yet 43% (245/571) of
the currently known pathogenic mutations cataloged in MITOMAP are found in these genes (Brandon et al., 2005; Putz

solid black line is a semi-logarithmic decision boundary established for that
region using a soft-margin Support Vector Machine (SVM) (see Materials
and Methods). SVM margins are shown as dashed lines. The associated
classification accuracy for region II was 87.2 _±_ 5.3%. The associated
classification accuracies for regions I and III were 60.0 _±_ 6.9 and
59.4 _±_ 7.0%, respectively. The SVM classification accuracy (mean and SD)
was established using fivefold validation (see Materials and Methods). Data
for the two tRNA species were collected separately from at least five
independent nanopore experiments.

et al., 2007; Ruiz-Pesini et al., 2007). The lack of a direct view
of transcribed mt.tRNA prevents use of sequence, modification state, and tRNA abundance as a facile diagnostic in mitochondrial pathology. We expect that a mature nanopore-based
method for directly sequencing individual tRNA molecules will
yield both canonical base identity and nucleotide modification
states along entire strands. This will help advance our understanding of tRNA biology and the diagnosis of mitochondrial
pathology as we fully appreciate the role of tRNA in human
disease.

Acknowledgments

Oxford Nanopore Technologies provided funding to support this
work (SC20130149), α-HL protein, initial study of ϕ29 DNAPmediated braking of RNA, and the cholesterol tagging strategy.
Jacob Schreiber developed software for nanopore event detection
and visualization. Dr. Todd Lowe provided _S. cerevisiae_ tRNA Phe

and Dr. Harry Noller provided _E. coli_ tRNA fMet and tRNA Lys .

Supplementary Material

The Supplementary Material for this article can be found online
[at http://journal.frontiersin.org/article/10.3389/fbioe.2015.00091](http://journal.frontiersin.org/article/10.3389/fbioe.2015.00091)

References

Akeson, M., Branton, D., Kasianowicz, J. J., Brandin, E., and Deamer, D. W. (1999).

Microsecond time-scale discrimination among polycytidylic acid, polyadenylic
acid, and polyuridylic acid as homopolymers or as segments within single RNA
molecules. _Biophys. J._ [77, 3227–3233. doi:10.1016/S0006-3495(99)77153-5](http://dx.doi.org/10.1016/S0006-3495%0x2899%0x2977153-5)
Ayub, M., and Bayley, H. (2012). Individual RNA base recognition in immobilized

oligonucleotides using a protein nanopore. _Nano_ _Lett._ 12, 5637–5643. [doi:10.](http://dx.doi.org/10.1021/nl3027873)
[1021/nl3027873](http://dx.doi.org/10.1021/nl3027873)
Bernick, D. L., Dennis, P. P., Höchsmann, M., and Lowe, T. M. (2012). Discovery

of pyrobaculum small RNA families with atypical pseudouridine guide RNA
features. _RNA_ [18, 402–411. doi:10.1261/rna.031385.111](http://dx.doi.org/10.1261/rna.031385.111)
Brandon, M. C., Lott, M. T., Nguyen, K. C., Spolim, S., Navathe, S. B., Baldi, P., et al.

(2005). MITOMAP: a human mitochondrial genome database  - 2004 update.
_Nucleic Acids Res._ [33, D611–D613. doi:10.1093/nar/gki079](http://dx.doi.org/10.1093/nar/gki079)
Chan, C. T. Y., Dyavaiah, M., DeMott, M. S., Taghizadeh, K., Dedon, P. C., and

Begley, T. J. (2010). A quantitative systems approach reveals dynamic control of
tRNA modifications during cellular stress. _PLoS Genet._ [6:e1001247. doi:10.1186/](http://dx.doi.org/10.1186/1477-3155-11-8)
[1477-3155-11-8](http://dx.doi.org/10.1186/1477-3155-11-8)
Chan, C. T. Y., Pang, Y. L. J., Deng, W., Babu, I. R., Dyavaiah, M., Begley, T. J.,

et al. (2012). Reprogramming of tRNA modifications controls the oxidative
stress response by codon-biased translation of proteins. _Nat_ _Commun_ 3, 937.
[doi:10.1038/ncomms1938](http://dx.doi.org/10.1038/ncomms1938)
Chan, P. P., Cozen, A. E., and Lowe, T. M. (2011). Discovery of permuted and

recently split transfer RNAs in _Archaea_ . _Genome_ _Biol._ 12, R38. [doi:10.1186/](http://dx.doi.org/10.1186/gb-2011-12-4-r38)
[gb-2011-12-4-r38](http://dx.doi.org/10.1186/gb-2011-12-4-r38)
Cherf, G. M., Lieberman, K. R., Rashid, H., Lam, C. E., Karplus, K., and Akeson, M.

(2012). Automated forward and reverse ratcheting of DNA in a nanopore at 5-Å
precision. _Nat. Biotechnol._ [30, 344–348. doi:10.1038/nbt.2147](http://dx.doi.org/10.1038/nbt.2147)
Cortes, C., and Vapnik, V. (1995). Support-vector networks. _Mach_ _Learn_ 20,

[273–297. doi:10.1007/BF00994018](http://dx.doi.org/10.1007/BF00994018)
Deamer, D. W., and Branton, D. (2002). Characterization of nucleic acids by

nanopore analysis. _Acc. Chem. Res._ [35, 817–825. doi:10.1021/ar000138m](http://dx.doi.org/10.1021/ar000138m)
Dittmar, K. A., Goodenbour, J. M., and Pan, T. (2006). Tissue-specific differences in

human transfer RNA expression. _PLoS Genet._ [2:e221. doi:10.1371/journal.pgen.](http://dx.doi.org/10.1371/journal.pgen.0020221)
[0020221](http://dx.doi.org/10.1371/journal.pgen.0020221)
Dominissini, D., Moshitch-Moshkovitz, S., Schwartz, S., Salmon-Divon, M., Ungar,

L., Osenberg, S., et al. (2012). Topology of the human and mouse m6A
RNA methylomes revealed by m6A-seq. _Nature_ 485, 201–206. [doi:10.1038/](http://dx.doi.org/10.1038/nature11112)
[nature11112](http://dx.doi.org/10.1038/nature11112)
Gustilo, E. M., Vendeix, F. A., and Agris, P. F. (2008). tRNA’s modifications bring

order to gene expression. _Curr. Opin. Microbiol._ [11, 134–140. doi:10.1016/j.mib.](http://dx.doi.org/10.1016/j.mib.2008.02.003)
[2008.02.003](http://dx.doi.org/10.1016/j.mib.2008.02.003)
Gyarfas, B., Olasagasti, F., Benner, S., Garalde, D. R., Lieberman, K., and Akeson,

M. (2009). Mapping the position of DNA polymerase-bound DNA templates in a nanopore at 5 Å resolution. _ACS_ _Nano_ 3, 1457–1466. [doi:10.1021/](http://dx.doi.org/10.1021/nn900303g)
[nn900303g](http://dx.doi.org/10.1021/nn900303g)
Hiley, S., Jackman, J., Babak, T., Trochesset, M., Morris, Q., Phizicky, E. M.,

et al. (2005). Detection and discovery of RNA modifications using microarrays.
_Nucleic Acids Res._ [33, e2. doi:10.1093/nar/gni002](http://dx.doi.org/10.1093/nar/gni002)
Karatzoglou, A., Smola, A., Hornik, K., and Zeileis, A. (2004). Kernlab - an S4

package for kernel methods in R. _J._ _Stat._ _Softw._ 11. Available at: [http://www.](http://www.jstatsoft.org/v11/i09/paper)
[jstatsoft.org/v11/i09/paper](http://www.jstatsoft.org/v11/i09/paper)
Kasianowicz, J. J., Brandin, E., Branton, D., and Deamer, D. W. (1996). Characteri
zation of individual polynucleotide molecules using a membrane channel. _Proc_
_Natl Acad Sci U.S.A._ [93, 13770–13773. doi:10.1073/pnas.93.24.13770](http://dx.doi.org/10.1073/pnas.93.24.13770)
Kirino, Y., Yasukawa, T., Ohta, S., Akira, S., Ishihara, K., Watanabe, K., et al. (2004).

Codon-specific translational defect caused by a wobble modification deficiency
in mutant tRNA from a human mitochondrial disease. _Proc Natl Acad Sci U.S.A._
[101, 15070–15075. doi:10.1073/pnas.0405173101](http://dx.doi.org/10.1073/pnas.0405173101)
Laszlo, A. H., Derrington, I. M., Brinkerhoff, H., Langford, K. W., Nova, I. C.,

Samson, J. M., et al. (2013). Detection and mapping of 5-methylcytosine and
5-hydroxymethylcytosine with nanopore MspA. _Proc Natl Acad Sci U.S.A._ 110,
[18904–18909. doi:10.1073/pnas.1310240110](http://dx.doi.org/10.1073/pnas.1310240110)
Laszlo, A. H., Derrington, I. M., Ross, B. C., Brinkerhoff, H., Adey, A., Nova, I. C.,

et al. (2014). Decoding long nanopore sequencing reads of natural DNA. _Nat._
_Biotechnol._ [32, 829–833. doi:10.1038/nbt.2950](http://dx.doi.org/10.1038/nbt.2950)
Lieberman, K. R., Cherf, G. M., Doody, M. J., Olasagasti, F., Kolodji, Y., and Akeson,

M. (2010). Processive replication of single DNA molecules in a nanopore

catalyzed by ϕ29 DNA polymerase. _J. Am. Chem. Soc._ [132, 17961–17972. doi:10.](http://dx.doi.org/10.1021/ja1087612)
[1021/ja1087612](http://dx.doi.org/10.1021/ja1087612)
Manrao, E. A., Derrington, I. M., Laszlo, A. H., Langford, K. W., Hopper, M. K.,

Gillgren, N., et al. (2012). Reading DNA at single-nucleotide resolution with a
mutant MspA nanopore and ϕ29 DNA polymerase. _Nat. Biotechnol._ 30, 349–353.
[doi:10.1038/nbt.2171](http://dx.doi.org/10.1038/nbt.2171)
Merino, E. J., Wilkinson, K. A., Coughlan, J. L., and Weeks, K. M. (2005). Selec
tive 2 _′_ -hydroxyl acylation analyzed by primer extension (SHAPE): quantitative
RNA structure analysis at single nucleotide resolution. _J._ _Am._ _Chem._ _Soc._ 127,
[4223–4231. doi:10.1021/ja043822v](http://dx.doi.org/10.1021/ja043822v)
Motorin, Y., and Helm, M. (2010). tRNA stabilization by modified nucleotides.

_Biochemistry_ [49, 4934–4944. doi:10.1021/bi100408z](http://dx.doi.org/10.1021/bi100408z)
Omer, A. D., Lowe, T. M., Russell, A. G., Ebhardt, H., Eddy, S., and Dennis, P.

(2000). Homologs of small nucleolar RNAs in _Archaea_ . _Science_ 288, 517–522.
[doi:10.1126/science.288.5465.517](http://dx.doi.org/10.1126/science.288.5465.517)
Phizicky, E. M., and Hopper, A. K. (2010). tRNA biology charges to the front. _Genes_

_Dev._ [24, 1832–1860. doi:10.1101/gad.1956510](http://dx.doi.org/10.1101/gad.1956510)
Putz, J., Dupuis, B., Sissler, M., and Florentz, C. (2007). Mamit-tRNA, a database of

mammalian mitochondrial tRNA primary and secondary structures. _RNA_ 13,
[1184–1190. doi:10.1261/rna.588407](http://dx.doi.org/10.1261/rna.588407)
Raina, M., and Ibba, M. (2014). tRNAs as regulators of biological processes. _Front._

_Genet._ [5:171. doi:10.3389/fgene.2014.00171](http://dx.doi.org/10.3389/fgene.2014.00171)
RajBhandary, U. (1994). Initiator transfer RNAs. _J. Bacteriol._ 176, 547–552.
Ruiz-Pesini, E., Lott, M. T., Procaccio, V., Poole, J. C., Brandon, M. C., Mishmar,

D., et al. (2007). An enhanced MITOMAP with a global mtDNA mutational
phylogeny. _Nucleic Acids Res._ [35, D823–D828. doi:10.1093/nar/gkl927](http://dx.doi.org/10.1093/nar/gkl927)
Saikia, M., Fu, Y., Pavon-Eternod, M., He, C., and Pan, T. (2010). Genome
wide analysis of N1-methyl-adenosine modification in human tRNAs. _RNA_ 16,
[1317–1327. doi:10.1261/rna.2057810](http://dx.doi.org/10.1261/rna.2057810)
Schaefer, M., Pollex, T., Hanna, K., and Lyko, F. (2009). RNA cytosine methylation

analysis by bisulfite sequencing. _Nucleic_ _Acids_ _Res._ 37, e12. [doi:10.1093/nar/](http://dx.doi.org/10.1093/nar/gkn954)
[gkn954](http://dx.doi.org/10.1093/nar/gkn954)
Schreiber, J., Wescoe, Z. L., Abu-Shumays, R., Vivian, J. T., Baatar, B., Karplus, K.,

et al. (2013). Error rates for nanopore discrimination among cytosine, methylcytosine, and hydroxymethylcytosine along individual DNA strands. _Proc Natl_
_Acad Sci U.S.A._ [110, 18910–18915. doi:10.1073/pnas.1310615110](http://dx.doi.org/10.1073/pnas.1310615110)
Serebrov, V., Clarke, R. J., Gross, H. J., and Kisselev, L. (2001). Mg 2+ -induced tRNA

folding. _Biochemistry_ [40, 6688–6698. doi:10.1021/bi002241p](http://dx.doi.org/10.1021/bi002241p)
Stein, A., and Crothers, D. M. (1976). Conformational changes of transfer RNA. The

role of magnesium(II). _Biochemistry_ [15, 160–168. doi:10.1021/bi00646a025](http://dx.doi.org/10.1021/bi00646a025)
Suzuki, T., Nagao, A., and Suzuki, T. (2011). Human mitochondrial diseases caused

by lack of taurine modification in mitochondrial tRNAs. _Wiley Interdiscip Rev_
_RNA_ [2, 376–386. doi:10.1002/wrna.65](http://dx.doi.org/10.1002/wrna.65)
Vilfan, I. D., Tsai, Y.-C., Clark, T. A., Wegener, J., Dai, Q., Yi, C., et al. (2013).

Analysis of RNA base modification and structural rearrangement by singlemolecule real-time detection of reverse transcription. _J. Nanobiotechnology._ 11,
[8. doi:10.1186/1477-3155-11-8](http://dx.doi.org/10.1186/1477-3155-11-8)
Wanunu, M., Dadosh, T., Ray, V., Jin, J., McReynolds, L., and Drndic, M. (2010).

Rapid electronic detection of probe-specific microRNAs using thin nanopore
sensors. _Nat. Nanotechnol._ [5, 807–814. doi:10.1038/nnano.2010.202](http://dx.doi.org/10.1038/nnano.2010.202)
Wescoe, Z. L., Schreiber, J., and Akeson, M. (2014). Nanopores discriminate among

five C5-cytosine variants in DNA. _J. Am. Chem. Soc._ [136, 16582–16587. doi:10.](http://dx.doi.org/10.1021/ja508527b)
[1021/ja508527b](http://dx.doi.org/10.1021/ja508527b)
Yasukawa, T., Suzuki, T., Ishii, N., Ohta, S., and Watanabe, K. (2001). Wobble modi
fication defect in tRNA disturbs codon-anticodon interaction in a mitochondrial
disease. _EMBO J._ [20, 4794–4802. doi:10.1093/emboj/20.17.4794](http://dx.doi.org/10.1093/emboj/20.17.4794)
Yi, C., and Pan, T. (2011). Cellular dynamics of RNA modification. _Acc. Chem. Res._

[44, 1380–1388. doi:10.1021/ar200057m](http://dx.doi.org/10.1021/ar200057m)

Conflict of Interest Statement: The authors declare the following competing
financial interest(s): Mark Akeson is a consultant to Oxford Nanopore Technologies.
Patent application: SC2014_725_PRV, Molecular adapter for capture and manipulation of tRNA.

_Copyright © 2015 Smith, Abu-Shumays, Akeson and Bernick. This is an open-access_
_[article distributed under the terms of the Creative Commons Attribution License (CC](http://creativecommons.org/licenses/by/4.0/)_
_[BY). The use, distribution or reproduction in other forums is permitted, provided the](http://creativecommons.org/licenses/by/4.0/)_
_original_ _author(s)_ _or_ _licensor_ _are_ _credited_ _and_ _that_ _the_ _original_ _publication_ _in_ _this_
_journal is cited, in accordance with accepted academic practice. No use, distribution_
_or reproduction is permitted which does not comply with these terms._

본문 출처 PDF: PDF 보기 · 다른 PDF는 위 [PDF 업로드]로 올릴 수 있습니다.

활용가능성

이력 0건

아직 편집 이력이 없습니다. 저장할 때마다 이전 내용이 여기에 백업됩니다.